Thyrotropin Releasing Hormone (TRH) Human qPCR Primer Pair (NM_007117)

CAT#: HP209907

qSTAR qPCR primer pairs against Homo sapiens gene TRH

Specifications

Product Data

• Gene ID: 7200
• Forward Sequence: CCTGGATGACTTCCTGCGCCA
• Reverse Sequence: TTGCCTGGATGCTGACGTTTGG
• Accession No: NM_007117, NM_007117.1, NM_007117.2, NM_007117.3, NM_007117.4, BC110515, BC069375, BC074888, BC074889, BC110516, BE670731
• UniProt ID: P20396
• Synonyms: Pro-TRH; TRF
• Component: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.