CALM1 Human qPCR Primer Pair (NM_006888)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
CALM1 (Myc-DDK-tagged)-Human calmodulin 1 (phosphorylase kinase, delta) (CALM1), transcript variant 1
USD 225.00
Other products for "CALM1"
Specifications
Product Data | |
Gene ID | 801 |
Forward Sequence | CCAACAGAAGCTGAATTGCAGGA |
Reverse Sequence | CAAAGACTCGGAATGCCTCACG |
Accession No | NM_006888, NM_006888.1, NM_006888.2, NM_006888.3, NM_006888.4, BC011834, BC000454, BC007965, BC008597, BC042831, BC047523, BT006818, BX479707, BX482177, BX537677, BX648223, NM_006888.6 |
UniProt ID | P62158 |
Synonyms | CALML2; caM; CAM2; CAM3; CAMB; CAMC; CAMI; CAMIII; CPVT4; DD132; LQT14; PHKD |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.