KLRA1 (KLRA1P) Human qPCR Primer Pair (NM_006611)

CAT#: HP209528

qSTAR qPCR primer pairs against Homo sapiens gene KLRA1

Specifications

Product Data

• Gene ID: 10748
• Forward Sequence: GGAACTGGATTCACGCCTTATAC
• Reverse Sequence: ACAGTTTACTCCACAACAGGACC
• Accession No: NM_006611, NM_006611.1, NM_006611.2, BC069672, BC069697, BC069734, BC101471, BC101473, BX950927
• Synonyms: A1; class I MHC receptor KLRA22; killer cell lectin-like receptor, subfamily A, member 1; KLRA#; Klra22; Ly-49L; Ly49; Ly49a; LY49L; Ly49o; Ly49v; MGC126520; MGC126522; natural killer cell receptor Ly49A; OTTMUSP00000026268
• Component: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.