Germany
Japan
United Kingdom
China
COL8A2 Human qPCR Primer Pair (NM_005202)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
Other products for "COL8A2"
Specifications
| Product Data | |
| Gene ID | 1296 |
| Forward Sequence | CGGGCGTCCTCTGGTGGCG |
| Reverse Sequence | TCCATCGGCAGCAGCGGTAGA |
| Accession No | NM_005202, NM_005202.1, NM_005202.2, NM_005202.3, BC096295, BC096296, BC096297, BC099645, NM_005202.4 |
| UniProt ID | P25067 |
| Synonyms | FECD; FECD1; PPCD; PPCD2 |
| Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.