Thyroid Hormone Receptor alpha (THRA) Human qPCR Primer Pair (NM_003250)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
THRA (Myc-DDK-tagged)-Human thyroid hormone receptor, alpha (THRA), transcript variant 2
USD 457.00
Other products for "THRA"
Specifications
Product Data | |
Gene ID | 7067 |
Forward Sequence | TGGATGACACGGAAGTGGCTCT |
Reverse Sequence | TACGCCTCCTGACTCTTCTCGA |
Accession No | NM_003250, NM_003250.1, NM_003250.2, NM_003250.3, NM_003250.4, NM_003250.5, BC000261, BC000261.1, BC008851, BC008851.2, BC035137, BC002728, BQ224043, NM_003250.6 |
UniProt ID | P10827 |
Synonyms | AR7; c-ERBA-1; CHNG6; EAR7; ERB-T-1; ERBA; ERBA1; NR1A1; THRA1; THRA2; TRalpha |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.