RPL15 Human qPCR Primer Pair (NM_002948)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
Lenti ORF particles, RPL15 (mGFP-tagged) - Human ribosomal protein L15 (RPL15), 200ul, >10^7 TU/mL
USD 850.00
Other products for "RPL15"
Specifications
Product Data | |
Gene ID | 6138 |
Forward Sequence | TACGGCAAGCCTGTCCATCATG |
Reverse Sequence | GTATGTGGAATCTTCACCAACCC |
Accession No | NM_002948, NM_002948.1, NM_002948.2, NM_002948.3, NM_002948.4, BC014837, BC014837.1, BC068198, BC068198.1, BC070328, BC071672, BC081565, BE893727, BT019672, BU178524, BX537495, NM_002948.5 |
UniProt ID | P61313 |
Synonyms | DBA12; EC45; L15; RPL10; RPLY10; RPYL10 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.