INHBB Human qPCR Primer Pair (NM_002193)

CAT#: HP205929

qSTAR qPCR primer pairs against Homo sapiens gene INHBB

USD 100.00


Availability*
5 Days

Size
    • 200 rxns

Product images

Specifications

Product Data
Gene ID 3625
Forward Sequence GAAATCATCAGCTTCGCCGAGAC
Reverse Sequence GGCAGGAGTTTCAGGTAAAGCC
Accession No BC030029, NM_002193
Synonyms MGC157939
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping when stored at -20 degrees C
Other products for "INHBB"
Frequently bought together (2)
Rabbit Polyclonal Anti-INHBB Antibody
    • 100 ul

USD 335.00


INHBB (Myc-DDK-tagged)-Human inhibin, beta B (INHBB)
    • 10 ug

USD 410.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones