GABPB2 (GABPB1) Human qPCR Primer Pair (NM_002041)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
GABPB1 (Myc-DDK-tagged)-Human GA binding protein transcription factor, beta subunit 1 (GABPB1), transcript variant gamma-1
USD 457.00
Other products for "GABPB1"
Specifications
Product Data | |
Gene ID | 2553 |
Forward Sequence | GCTGAAGCATCTGCTCCATTGTC |
Reverse Sequence | GCTGAATGGCACCATCCACAGA |
Accession No | NM_002041, NM_002041.1, NM_002041.2, NM_002041.3, NM_002041.4, BC016910, BC036080, BC036080.1, BC050702, BC050702.1, BE644609, BQ430343, BQ573816, BT006652 |
UniProt ID | Q06547 |
Synonyms | BABPB2; E4TF1; E4TF1-47; E4TF1-53; E4TF1B; GABPB; GABPB-1; GABPB2; NRF2B1; NRF2B2 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.