MIR4465 Human qPCR Template Standard (MI0016816)

CAT#: HK300975

MIR4465 (Human) qSTAR miRNA primer pairs + Copy number standard kit



SensiMix SYBR Master Mix

USD 389.00

2 Weeks*

Size
    • 200 reactions

Product Images

Other products for "MIR4465"

Specifications

Product Data
Application Plasmid of exact quantity for transcript copy number calculation
Forward Sequence CTCAAGTAGTCTGACCAGGG
Reverse Sequence GAACATGTCTGCGTATCTC
Accession No MIMAT0018992
Synonyms hsa-miR-4465; MI0016816; MIMAT0018992; MIR4465 hsa-mir-4465
Components 1 vial of lyophilized SybGREEN qPCR miRNA primer mix (1 nmol each primer, sufficient for 200 reactions), 1 vial lyophilized qPCR miRNA template standard: 50 X 10^7 copies (100 reactions)
Quality Control Each standard is generated using qSTAR miRNA primer pairs and sequence-verified prior to shipment
Storage The primer mix and template standard are stable for one year from date of shipping. Store at -20°C.

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.