CELA1 (NM_001971) Human 3' UTR Clone

CAT#: SC201149

3' UTR clone of chymotrypsin-like elastase family member 1 (CELA1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CELA1
• Synonyms: ELA1
• ACCN: NM_001971
• Insert Size: 165 bp
• Sequence Data:
  Insert Sequence

  >SC201149 3’UTR clone of NM_001971
  The sequence shown below is from the reference sequence of NM_001971. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  TGGATAAATAATGTCATCGCCTCCAACTGAACATTTTCCTGAGTCCAACGACCTTCCCAAAATGGTTCT
  TAGATCTGCAGTAGGACTTGCGATCAAAAAGTAAAACACATTCTGAAAGACTATTGAGCCATTGATAGA
  AAAGCAAATAAAACTAGATATACATTA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001971.6
• Summary: Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Unlike other elastases, pancreatic elastase 1 is not expressed in the pancreas. To date, elastase 1 expression has only been detected in skin keratinocytes. Clinical literature that describes human elastase 1 activity in the pancreas or fecal material is actually referring to chymotrypsin-like elastase family, member 3B. [provided by RefSeq, May 2009]
• Locus ID: 1990
• MW: 6.4