OriGene Technologies, Inc.
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
HomecDNA Clone TrueORF

TrueORF® cDNA Clones: Ready-to-Use Tagged cDNA Clones

divider
TrueORF Gold Video

TrueORF® cDNA clones are tagged cDNA clones for protein studies.

  • Genome wide coverage for human, mouse and rat
  • Two types of tags: Myc-DDK tagged or GFP tagged
  • New: Lenti options are now available.
  • 20,000 Human clones are validated for protein expression
  • 70 destination vectors for additional applications
  • Clone collections available
TrueORF Gold
Clone Finder
Search your clone, type clone name, symbol, accession number or keyword in the box below.
The clones indicated with the crown icons are TrueORF Gold clones.
spacer

TrueORF Vectors Comparison Chart

  pCMV6-Entry pCMV6-AC-GFP pLenti-C-Myc-DDK pLenti-C-mGFP
Vector SKU PS100001 PS100010 PS100064 PS100071
Vector Map pCMV6 Entry Vector Map pCMV6-AC-GFP Vector Map pLenti-C-Myc-DDK Vector Map pLenti-C-mGFP Vector Map
Fusion Tag C-terminal Myc-DDK C-terminal tGFP C-terminal Myc-DDK C-terminal mGFP
Ideal For Detection and pufirication of over-expressed protein Tracking the over-expressed protein in tranfected cells In hard-to-transfect cells: Detection and purification of over-expressed protein Tracking the over-expressed protein in tranfected cells
ORF Clone SKUs RC2XXXXX RG2XXXXX RC2XXXXXL1 RC2XXXXXL2

Technical features of TrueORF:

  • The CMV promoter and a Kozak consensus sequence drive protein expression in mammalian cells.
  • The C-terminus of the ORF is tagged with Myc/DDK* or tGFP.
  • Ten (10) ug of purified plasmid is provided for immediate transfection and expression experiments.
  • The upstream T7 promoter allows protein expression in cell-free system.
  • Engineered as the entry vector for the OriGene PrecisionShuttle system.

Each TrueORF Clone is provided with a pair of sequencing primers:

Primer namePrimer sequence (for sequencing)
VP1.5 (forward)5' GGACTTTCCAAAATGTCG 3'
XL39 (reverse)5' ATTAGGACAAGGCTGGTGGG 3'

View Location on Vectors
Add to cart

 

* Peptide sequence of the DDK-tag (Flag®): N-DYKDDDDK-C Flag® is a registered trademark of Sigma-Aldrich

 

spacer
Inc 5000 Healthcare Company Copyright © 2014 OriGene Technologies, Inc. All Rights Reserved. Legal Notices.
9620 Medical Center Dr., Suite 200, Rockville, MD 20850 • 1.888.267.4436

Reproduction of any materials from this website is strictly forbidden without permission.

All Products by: Title | Price | Category | Popularity | Best Sellers Topselling Products by: Title | Price | Category | Popularity | Favorites
Popular Categories: Popularity | Our Choices | All-Round Favorites | Title Topselling Categories: Popularity | Our Choices | All-Round Favorites | Title