SDHB (NM_003000) Human Untagged Clone

CAT#: SC319204

SDHB (untagged)-Human succinate dehydrogenase complex, subunit B, iron sulfur (Ip) (SDHB), nuclear gene encoding mitochondrial protein


  "NM_003000" in other vectors (6)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
SDHB mouse monoclonal antibody, clone OTI3F5 (formerly 3F5)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "SDHB"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SDHB
Synonyms CWS2; IP; MC2DN4; PGL4; SDH; SDH1; SDH2; SDHIP
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_003000.2 ACCCGGGAAACCGGAAGCCGCCTCCCACTTGGTTGCTCGTACGCGGCTAGTGGGTCCTCA
GTGGATGTAGGCTGGGCGCCGCGATGTTCGACGGGACACCGGCGGAGAGCGACCTCGGGG
TTAAGGGGTGGGGCTGACGTCAGGAGCCAAGATGGCGGCGGTGGTCGCACTCTCCTTGAG
GCGCCGGTTGCCGGCCACAACCCTTGGCGGAGCCTGCCTGCAGGCCTCCCGAGGAGCCCA
GACAGCTGCAGCCACAGCTCCCCGTATCAAGAAATTTGCCATCTATCGATGGGACCCAGA
CAAGGCTGGAGACAAACCTCATATGCAGACTTATGAAGTTGACCTTAATAAATGTGGCCC
CATGGTATTGGATGCTTTAATCAAGATTAAGAATGAAGTTGACTCTACTTTGACCTTCCG
AAGATCATGCAGAGAAGGCATCTGTGGCTCTTGTGCAATGAACATCAATGGAGGCAACAC
TCTAGCTTGCACCCGAAGGATTGACACCAACCTCAATAAGGTCTCAAAAATCTACCCTCT
TCCACACATGTATGTGATAAAGGATCTTGTTCCCGATTTGAGCAACTTCTATGCACAGTA
CAAATCCATTGAGCCTTATTTGAAGAAGAAGGATGAATCTCAGGAAGGCAAGCAGCAGTA
TCTGCAGTCCATAGAAGAGCGTGAGAAACTGGACGGGCTCTACGAGTGCATTCTCTGTGC
CTGCTGTAGCACCAGCTGCCCCAGCTACTGGTGGAACGGAGACAAATATCTGGGGCCTGC
AGTTCTTATGCAGGCCTATCGCTGGATGATTGACTCCAGAGATGACTTCACAGAGGAGCG
CCTGGCCAAGCTGCAGGACCCATTCTCTCTATACCGCTGCCACACCATCATGAACTGCAC
AAGGACCTGTCCTAAGGGTCTGAATCCAGGGAAAGCTATTGCAGAGATCAAGAAAATGAT
GGCAACCTATAAGGAGAAGAAAGCTTCAGTTTAACTGTTTCCATGCTAAACATGATTTAT
AACCAGCTCAGAGCTGAACATAATTTATATCTAATTTGAGTTCCTTTAAAGATCTTGGTT
TTCCATGAATACAGCATGTATAATAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_003000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003000.2, NP_002991.2
RefSeq Size 1161 bp
RefSeq ORF 843 bp
Locus ID 6390
UniProt ID P21912
Cytogenetics 1p36.13
Domains fer2
Protein Families Druggable Genome
Protein Pathways Alzheimer's disease, Citrate cycle (TCA cycle), Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
Gene Summary Complex II of the respiratory chain, which is specifically involved in the oxidation of succinate, carries electrons from FADH to CoQ. The complex is composed of four nuclear-encoded subunits and is localized in the mitochondrial inner membrane. The iron-sulfur subunit is highly conserved and contains three cysteine-rich clusters which may comprise the iron-sulfur centers of the enzyme. Sporadic and familial mutations in this gene result in paragangliomas and pheochromocytoma, and support a link between mitochondrial dysfunction and tumorigenesis. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.