TADA3L (TADA3) (NM_001278270) Human Untagged Clone

CAT#: SC336086

TADA3 (untagged) - Human transcriptional adaptor 3 (TADA3), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TADA3L
• Synonyms: ADA3; hADA3; NGG1; STAF54; TADA3L
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC336086 representing NM_001278270.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGAGTGAGTTGAAAGACTGCCCCTTGCAGTTCCACGACTTCAAGTCTGTGGATCACCTGAAGGTCTGT
  CCCCGCTACACGGCAGTGCTGGCACGCTCTGAGGATGATGGCATCGGCATCGAGGAGCTGGACACCCTG
  CAGCTGGAGCTGGAGACCCTGCTGTCTTCTGCCAGCCGGCGCCTGCGTGTGCTTGAGGCCGAAACCCAG
  ATCCTCACCGACTGGCAGGATAAGAAAGGTGACAGACGATTCCTGAAGCTGGGTCGAGACCATGAACTT
  GGAGCTCCCCCCAAACATGGGAAGCCCAAGAAGCAGAAACTGGAAGGGAAGGCAGGACATGGGCCGGGC
  CCTGGCCCAGGACGGCCCAAATCCAAAAACCTTCAGCCCAAGATCCAGGAATATGAATTCACTGATGAC
  CCTATCGACGTGCCACGGATCCCCAAAAATGATGCCCCCAACAGGTTCTGGGCTTCAGTGGAGCCCTAC
  TGTGCTGACATCACCAGCGAGGAGGTCCGCACACTTGAGGAGTTACTGAAGCCCCCAGAAGATGAGGCT
  GAGCATTACAAGATCCCACCCCTGGGGAAGCACTACTCCCAGCGCTGGGCCCAGGAGGACCTGCTGGAG
  GAGCAGAAGGATGGGGCCCGGGCAGCGGCTGTGGCTGACAAGAAGAAAGGCCTCATGGGGCCACTGACC
  GAACTGGACACTAAAGATGTGGATGCCCTGCTGAAGAAGTCTGAGGCCCAGCATGAACAGCCGGAAGAT
  GGATGCCCCTTTGGTGCCCTGACGCAGCGCCTCCTGCAGGCCCTGGTGGAGGAAAATATTATTTCCCCT
  ATGGAGGATTCTCCTATTCCTGACATGTCTGGGAAAGAATCAGGGGCTGACGGGGCAAGCACCTCCCCT
  CGCAATCAGAACAAGCCCTTCAGTGTGCCGCATACTAAGTCCCTGGAGAGCCGCATCAAGGAGGAGCTA
  ATTGCCCAGGGCCTTTTGGAGTCTGAGGACCGCCCCGCAGAGGACTCCGAGGATGAGGTCCTTGCTGAG
  CTTCGCAAACGGCAGGCTGAGCTGAAGGCACTTAGTGCCCACAACCGCACCAAGAAGCACGACCTGCTG
  AGGCTGGCAAAGGAGGAGGTGAGCCGGCAGGAGCTGAGGCAGCGGGTGCGCATGGCTGACAACGAGGTC
  ATGGACGCCTTTCGCAAGATCATGGCTGCCCGGCAGAAGAAGCGGACTCCCACCAAGAAAGAAAAGGAC
  CAGGCCTGGAAGACTCTGAAGGAGCGTGAGAGCATCCTGAAGCTGCTGGATGGGTAG
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278270
• Insert Size: 1299 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278270.1
• RefSeq Size: 1924 bp
• RefSeq ORF: 1299 bp
• Locus ID: 10474
• UniProt ID: O75528
• Cytogenetics: 3p25.3
• Protein Families: Transcription Factors
• MW: 48.9 kDa
• Gene Summary: DNA-binding transcriptional activator proteins increase the rate of transcription by interacting with the transcriptional machinery bound to the basal promoter in conjunction with adaptor proteins, possibly by acetylation and destabilization of nucleosomes. The protein encoded by this gene is a transcriptional activator adaptor and a component of the histone acetyl transferase (HAT) coactivator complex which plays a crucial role in chromatin modulation and cell cycle progression. Along with the other components of the complex, this protein links transcriptional activators bound to specific promoters, to histone acetylation and the transcriptional machinery. The protein is also involved in the stabilization and activation of the p53 tumor suppressor protein that plays a role in the cellular response to DNA damage. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
  Transcript Variant: This variant (3) uses an alternate splice site in the 5' UTR compared to variant 1. Variants 1 and 3 encode the same isoform (a).