Prohibitin (PHB) (NM_001281497) Human Untagged Clone
CAT#: SC334013
PHB (untagged) - Human prohibitin (PHB), transcript variant 3
"NM_001281497" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "Prohibitin"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | Prohibitin |
Synonyms | HEL-215; HEL-S-54e; PHB1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC334013 representing NM_001281497.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTGCCAAAGTGTTTGAGTCCATTGGCAAGTTTGGCCTGGCCTTAGCTGTTGCAGGAGGCGTGGTG AACTCTGCCTTATATAATGTGGATGCTGGGCACAGAGCTGTCATCTTTGACCGATTCCGTGGAGTGCAG GACATTGTGGTAGGGGAAGGGACTCATTTTCTCATCCCGTGGGTACAGAAACCAATTATCTTTGACTGC CGTTCTCGACCACGTAATGTGCCAGTCATCACTGGTAGCAAAGATTTACAGAATGTCAACATCACACTG CGCATCCTCTTCCGGCCTGTCGCCAGCCAGCTTCCTCGCATCTTCACCAGCATCGGAGAGGACTATGAT GAGCGTGTGCTGCCGTCCATCACAACTGAGATCCTCAAGTCAGTGGTGGCTCGCTTTGATGCTGGAGAA CTAATCACCTACCTGCCAGCGGGGCAGTCCGTGCTCCTCCAGCTGCCCCAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001281497 |
Insert Size | 468 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001281497.1 |
RefSeq Size | 1520 bp |
RefSeq ORF | 468 bp |
Locus ID | 5245 |
UniProt ID | P35232 |
Cytogenetics | 17q21.33 |
Protein Families | Druggable Genome, Stem cell - Pluripotency, Transcription Factors |
MW | 17 kDa |
Gene Summary | This gene is evolutionarily conserved, and its product is proposed to play a role in human cellular senescence and tumor suppression. Antiproliferative activity is reported to be localized to the 3' UTR, which is proposed to function as a trans-acting regulatory RNA. Several pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (3) uses alternate in-frame splice sites and lacks an alternate in-frame exon in the coding region compared to variant 1. It encodes isoform 2 which is shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.