SAP18 (NM_005870) Human Untagged Clone

CAT#: SC327746

SAP18 (untagged)-Human Sin3A-associated protein 18kDa (SAP18)


  "NM_005870" in other vectors (7)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
SAP18 Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "SAP18"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SAP18
Synonyms 2HOR0202; SAP18P
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC327746 representing NM_005870.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTCGCTGCAGGGGTCGGAGGTCAGGGCGAGCGTCTCGCAGGCCGTAGGAGGAAGATGGCGGTGGAG
TCGCGCGTTACCCAGGAGGAAATTAAGAAGGAGCCAGAGAAACCGATCGACCGCGAGAAGACATGCCCA
CTGTTGCTACGGGTCTTCACCACCAATAACGGCCGCCACCACCGAATGGACGAGTTCTCCCGGGGAAAT
GTACCGTCCAGCGAGTTGCAGATCTACACTTGGATGGATGCAACCTTGAAAGAACTGACAAGCTTAGTA
AAAGAAGTCTACCCAGAAGCTAGAAAGAAGGGCACTCACTTCAATTTTGCAATCGTTTTTACAGATGTT
AAAAGACCTGGCTATCGAGTTAAGGAGATTGGCAGCACCATGTCTGGCAGAAAGGGGACTGATGATTCC
ATGACCCTGCAGTCGCAGAAGTTCCAGATAGGAGATTACTTGGACATAGCAATTACCCCTCCAAATCGG
GCACCACCTCCTTCAGGGCGCATGAGACCATATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_005870
Insert Size 519 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005870.4
RefSeq Size 2318 bp
RefSeq ORF 519 bp
Locus ID 10284
UniProt ID O00422
Cytogenetics 13q12.11
Protein Families Druggable Genome, Transcription Factors
MW 19.5 kDa
Gene Summary Histone acetylation plays a key role in the regulation of eukaryotic gene expression. Histone acetylation and deacetylation are catalyzed by multisubunit complexes. The protein encoded by this gene is a component of the histone deacetylase complex, which includes SIN3, SAP30, HDAC1, HDAC2, RbAp46, RbAp48, and other polypeptides. This protein directly interacts with SIN3 and enhances SIN3-mediated transcriptional repression when tethered to the promoter. A pseudogene has been identified on chromosome 2. [provided by RefSeq, Dec 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.