IDH3G (NM_004135) Human Untagged Clone

CAT#: SC323781

IDH3G (untagged)-Human isocitrate dehydrogenase 3 (NAD+) gamma (IDH3G), nuclear gene encoding mitochondrial protein, transcript variant 1


  "NM_004135" in other vectors (7)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-IDH3G Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "IDH3G"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IDH3G
Synonyms H-IDHG
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_004135.2 GGTATCTGCGTGTCGGGACGTGCGGAGGCTCTCACTTTCCGTCATGGCGCTGAAGGTAGC
GACCGTCGCCGGCAGCGCCGCGAAGGCGGTGCTCGGGCCAGCCCTTCTCTGCCGTCCCTG
GGAGGTTCTAGGCGCCCACGAGGTCCCCTCGAGGAACATCTTTTCAGAACAAACAATTCC
TCCGTCCGCTAAGTATGGCGGGCGGCACACGGTGACCATGATCCCAGGGGATGGCATCGG
GCCAGAGCTCATGCTGCATGTCAAGTCCGTCTTCAGGCACGCATGTGTACCAGTGGACTT
TGAAGAGGTGCACGTGAGTTCCAATGCTGATGAAGAGGACATTCGCAATGCCATCATGGC
CATCCGCCGGAACCGCGTGGCCCTGAAGGGCAACATCGAAACCAACCATAACCTGCCACC
GTCGCACAAATCTCGAAACAACATCCTTCGCACCAGCCTGGACCTCTATGCCAACGTCAT
CCACTGTAAGAGCCTTCCAGGCGTGGTGACCCGGCACAAGGACATAGACATCCTCATTGT
CCGGGAGAACACAGAGGGCGAGTACAGCAGCCTGGAGCATGAGAGTGTGGCGGGAGTGGT
GGAGAGCCTGAAGATCATCACCAAGGCCAAGTCCCTGCGCATTGCCGAGTATGCCTTCAA
GCTGGCGCAGGAGAGCGGGCGCAAGAAAGTGACGGCCGTGCACAAGGCCAACATCATGAA
ACTGGGCGATGGGCTTTTCCTCCAGTGCTGCAGGGAGGTGGCAGCCCGCTACCCTCAGAT
CACCTTCGAGAACATGATTGTGGATAACACCACCATGCAGCTGGTGTCCCGGCCCCAGCA
GTTTGATGTCATGGTGATGCCCAATCTCTATGGCAACATCGTCAACAATGTCTGCGCGGG
ACTGGTCGGGGGCCCAGGCCTTGTGGCTGGGGCCAACTATGGCCATGTGTACGCGGTGTT
TGAAACAGCTACGAGGAACACCGGCAAGAGTATCGCCAATAAGAACATCGCCAACCCCAC
GGCCACCCTGCTGGCCAGCTGCATGATGCTGGACCACCTCAAGCTGCACTCCTATGCCAC
CTCCATCCGTAAGGCTGTCCTGGCATCCATGGACAATGAGAATATGCACACTCCGGACAT
CGGGGGCCAGGGCACAACATCTGAAGCCATCCAGGACGTCATCCGCCACATCCGCGTCAT
CAACGGCCGGGCCGTGGAGGCCTAGGCTGGCCCTAGGACCTTCTTGGTTTGCTCCTTGGA
TTCCCCTTCCCACTCCAGCACCCCAGCCAGCCTGGTACGCAGATCCCAGAATAAAGCACC
TTCTCCCTAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAA
Restriction Sites ECoRI-NOT     
ACCN NM_004135
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004135.2, NP_004126.1
RefSeq Size 1500 bp
RefSeq ORF 1182 bp
Locus ID 3421
UniProt ID P51553
Cytogenetics Xq28
Domains isodh
Protein Pathways Citrate cycle (TCA cycle), Metabolic pathways
Gene Summary Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the gamma subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. This gene is a candidate gene for periventricular heterotopia. Several alternatively spliced transcript variants of this gene have been described, but only some of their full length natures have been determined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the longer isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.