THTPA (NM_001126339) Human Untagged Clone

CAT#: SC322907

THTPA (untagged)-Human thiamine triphosphatase (THTPA), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: THTPA
• Synonyms: THTP; THTPASE
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC322907 representing NM_001126339.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCCCAGGGCTTGATTGAGGTGGAGCGAAAGTTCCTTCCAGGGCCTGGCACAGAGGAGCGGCTGCAG
  GAGTTGGGGGGCACCCTGGAGTACCGGGTCACCTTCCGAGACACCTACTATGACACCCCTGAGCTGAGC
  CTCATGCAGGCTGACCACTGGCTGCGACGACGAGAGGATAGTGGATGGGAGCTCAAATGTCCTGGAGCA
  GCAGGTGTCTTAGGACCCCACACGGAGTATAAGGAACTCACAGCGGAACCTACAATTGTGGCCCAACTC
  TGTAAGGTGCTGCGGGCTGACGGCCTGGGGGCTGGAGATGTGGCTGCTGTGCTGGGCCCACTGGGGCTG
  CAGGAAGTAGCTAGTTTTGTGACTAAGCGGAGTGCCTGGAAGCTGGTGCTCTTGGGAGCTGATGAAGAG
  GAGCCACAGCTCAGGGTGGACTTGGATACAGCCGACTTTGGCTACGCTGTGGGTGAGGTAGAGGCCCTG
  GTGCATGAGGAGGCTGAAGTACCAACTGCCCTAGAGAAGATCCACAGGCTCAGCAGCATGCTTGGTGTG
  CCTGCACAGGAGACAGCACCAGCCAAGCTGATTGTGTATCTACAGCGTTTCCGGCCTCAAGACTATCAG
  CGCCTGCTAGAAGTGAACAGCTCCAGAGAGAGGCCACAGGAGACTGAAGATCCTGACCACTGCCTGGGC
  TAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001126339
• Insert Size: 693 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001126339.3
• RefSeq Size: 1829 bp
• RefSeq ORF: 693 bp
• Locus ID: 79178
• UniProt ID: Q9BU02
• Cytogenetics: 14q11.2
• Protein Pathways: Metabolic pathways, Thiamine metabolism
• MW: 25.6 kDa
• Gene Summary: This gene encodes an enzyme which catalyzes the biosynthesis of thiamine disphophate (vitamin B1) by hydrolysis of thiamine triphosphate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (2) lacks a segment of the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same isoform (1).