VAV3 (NM_001079874) Human Untagged Clone

CAT#: SC315719

VAV3 (untagged)-Human vav 3 guanine nucleotide exchange factor (VAV3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: VAV3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC315719 representing NM_001079874.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCCAATTTTTACATTTCTTTCAGAACAAGGGACACTCAAACTACCAGAGAAACGGACCAATGGACTG
  CGAAGAACTCCTAAACAGGTGGATCCAGGTTTACCAAAGATGCAGGTCATTAGGAACTATTCTGGAACA
  CCACCCCCAGCTCTGCATGAAGGACCCCCTTTACAGCTCCAGGCCGGGGATACCGTTGAACTTCTGAAA
  GGAGATGCACACAGTCTGTTTTGGCAGGGCAGAAATTTAGCATCTGGAGAGGTTGGATTTTTTCCAAGT
  GATGCAGTCAAGCCTTGCCCATGTGTGCCCAAACCAGTAGATTATTCTTGCCAACCCTGGTATGCTGGA
  GCAATGGAAAGATTGCAAGCAGAGACCGAACTTATTAATAGGGTAAATAGTACTTACCTTGTGAGGCAC
  AGGACCAAAGAGTCAGGAGAATATGCAATTAGCATTAAGTACAATAATGAAGCAAAGCACATCAAGATT
  TTAACAAGAGATGGCTTTTTTCACATTGCAGAAAATAGAAAATTTAAAAGTTTAATGGAACTTGTGGAG
  TACTACAAGCATCATTCTCTCAAGGAAGGGTTCAGAACCTTAGATACAACTCTGCAGTTTCCATACAAG
  GAGCCAGAACATTCAGCTGGACAGAGGGGTAATAGAGCAGGCAACAGCTTGTTAAGTCCAAAAGTGCTG
  GGCATTGCCATCGCTCGGTATGACTTCTGTGCAAGAGATATGAGAGAGTTGTCCTTGTTGAAAGGAGAT
  GTGGTGAAGATTTACACAAAGATGAGTGCAAATGGCTGGTGGAGAGGAGAAGTAAATGGCAGGGTGGGC
  TGGTTTCCATCCACATATGTGGAAGAGGATGAATAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001079874
• Insert Size: 864 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001079874.1
• RefSeq Size: 3115 bp
• RefSeq ORF: 864 bp
• Locus ID: 10451
• UniProt ID: Q9UKW4
• Cytogenetics: 1p13.3
• Protein Families: Druggable Genome
• Protein Pathways: B cell receptor signaling pathway, Chemokine signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Leukocyte transendothelial migration, Natural killer cell mediated cytotoxicity, Regulation of actin cytoskeleton, T cell receptor signaling pathway
• MW: 32.6 kDa
• Gene Summary: This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. This gene product acts as a GEF preferentially for RhoG, RhoA, and to a lesser extent, RAC1, and it associates maximally with the nucleotide-free states of these GTPases. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2, also known as vav3.1) contains a novel 5' exon, and is missing most of the exons found in the 5' half of variant 1. This is a shorter isoform, and consists mostly of the C-terminal SH3-SH2-SH3 region.