LCK (NM_001042771) Human Untagged Clone

CAT#: SC311484

LCK (untagged)-Human lymphocyte-specific protein tyrosine kinase (LCK), transcript variant 1


  "NM_001042771" in other vectors (4)

Reconstitution Protocol

USD 759.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
Rabbit polyclonal LCK Antibody (N-term)
    • 400 ul

USD 580.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LCK
Synonyms IMD22; LSK; p56lck; pp58lck; YT16
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC311484 representing NM_001042771.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCTGTGGCTGCAGCTCACACCCGGAAGATGACTGGATGGAAAACATCGATGTGTGTGAGAACTGC
CATTATCCCATAGTCCCACTGGATGGCAAGGGCACGCTGCTCATCCGAAATGGCTCTGAGGTGCGGGAC
CCACTGGTTACCTACGAAGGCTCCAATCCGCCGGCTTCCCCACTGCAAGACAACCTGGTTATCGCTCTG
CACAGCTATGAGCCCTCTCACGACGGAGATCTGGGCTTTGAGAAGGGGGAACAGCTCCGCATCCTGGAG
CAGAGCGGCGAGTGGTGGAAGGCGCAGTCCCTGACCACGGGCCAGGAAGGCTTCATCCCCTTCAATTTT
GTGGCCAAAGCGAACAGCCTGGAGCCCGAACCCTGGTTCTTCAAGAACCTGAGCCGCAAGGACGCGGAG
CGGCAGCTCCTGGCGCCCGGGAACACTCACGGCTCCTTCCTCATCCGGGAGAGCGAGAGCACCGCGGGA
TCGTTTTCACTGTCGGTCCGGGACTTCGACCAGAACCAGGGAGAGGTGGTGAAACATTACAAGATCCGT
AATCTGGACAACGGTGGCTTCTACATCTCCCCTCGAATCACTTTTCCCGGCCTGCATGAACTGGTCCGC
CATTACACCAATGCTTCAGATGGGCTGTGCACACGGTTGAGCCGCCCCTGCCAGACCCAGAAGCCCCAG
AAGCCGTGGTGGGAGGACGAGTGGGAGGTTCCCAGGGAGACGCTGAAGCTGGTGGAGCGGCTGGGGGCT
GGACAGTTCGGGGAGGTGTGGATGGGGTACTACAACGGGCACACGAAGGTGGCGGTGAAGAGCCTGAAG
CAGGGCAGCATGTCCCCGGACGCCTTCCTGGCCGAGGCCAACCTCATGAAGCAGCTGCAACACCAGCGG
CTGGTTCGGCTCTACGCTGTGGTCACCCAGGAGCCCATCTACATCATCACTGAATACATGGAGAATGGG
AGTCTAGTGGATTTTCTCAAGACCCCTTCAGGCATCAAGTTGACCATCAACAAACTCCTGGACATGGCA
GCCCAAATTGCAGAAGGCATGGCATTCATTGAAGAGCGGAATTATATTCATCGTGACCTTCGGGCTGCC
AACATTCTGGTGTCTGACACCCTGAGCTGCAAGATTGCAGACTTTGGCCTAGCACGCCTCATTGAGGAC
AACGAGTACACAGCCAGGGAGGGGGCCAAGTTTCCCATTAAGTGGACAGCGCCAGAAGCCATTAACTAC
GGGACATTCACCATCAAGTCAGATGTGTGGTCTTTTGGGATCCTGCTGACGGAAATTGTCACCCACGGC
CGCATCCCTTACCCAGGGATGACCAACCCGGAGGTGATTCAGAACCTGGAGCGAGGCTACCGCATGGTG
CGCCCTGACAACTGTCCAGAGGAGCTGTACCAACTCATGAGGCTGTGCTGGAAGGAGCGCCCAGAGGAC
CGGCCCACCTTTGACTACCTGCGCAGTGTGCTGGAGGACTTCTTCACGGCCACAGAGGGCCAGTACCAG
CCTCAGCCTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001042771
Insert Size 1530 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001042771.2
RefSeq Size 2102 bp
RefSeq ORF 1530 bp
Locus ID 3932
UniProt ID P06239
Cytogenetics 1p35.2
Protein Families Druggable Genome, Protein Kinase, Stem cell - Pluripotency
Protein Pathways Natural killer cell mediated cytotoxicity, Primary immunodeficiency, T cell receptor signaling pathway
MW 58 kDa
Gene Summary This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (1) is transcribed from the proximal type I promoter. Variants 1 and 2 encode the same isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.