DYRK1A (NM_101395) Human Untagged Clone

CAT#: SC309491

DYRK1A (untagged)-Human dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A (DYRK1A), transcript variant 3


  "NM_101395" in other vectors (4)

Reconstitution Protocol

USD 871.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "DYRK1A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DYRK1A
Synonyms DYRK; DYRK1; HP86; MNB; MNBH; MRD7
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_101395, the custom clone sequence may differ by one or more nucleotides
ATGCATACAGGAGGAGAGACTTCAGCATGCAAACCTTCATCTGTTCGGCTTGCACCGTCA
TTTTCATTCCATGCTGCTGGCCTTCAGATGGCTGGACAGATGCCCCATTCACATCAGTAC
AGTGACCGTCGCCAGCCAAACATAAGTGACCAACAGGTTTCTGCCTTATCATATTCTGAC
CAGATTCAGCAACCTCTAACTAACCAGGTGATGCCTGATATTGTCATGTTACAGAGGCGG
ATGCCCCAAACCTTCCGTGACCCAGCAACTGCTCCCCTGAGAAAACTTTCTGTTGACTTG
ATCAAAACATACAAGCATATTAATGAGGTTTACTATGCAAAAAAGAAGCGAAGACACCAA
CAGGGCCAGGGAGACGATTCTAGTCATAAGAAGGAACGGAAGGTTTACAATGATGGTTAT
GATGATGATAACTATGATTATATTGTAAAAAACGGAGAAAAGTGGATGGATCGTTACGAA
ATTGACTCCTTGATAGGCAAAGGTTCCTTTGGACAGGTTGTAAAGGCATATGATCGTGTG
GAGCAAGAATGGGTTGCCATTAAAATAATAAAGAACAAGAAGGCTTTTCTGAATCAAGCA
CAGATAGAAGTGCGACTTCTTGAGCTCATGAACAAACATGACACTGAAATGAAATACTAC
ATAGTGCATTTGAAACGCCACTTTATGTTTCGAAACCATCTCTGTTTAGTTTTTGAAATG
CTGTCCTACAACCTCTATGACTTGCTGAGAAACACCAATTTCCGAGGGGTCTCTTTGAAC
CTAACACGAAAGTTTGCGCAACAGATGTGCACTGCACTGCTTTTCCTTGCGACTCCAGAA
CTTAGTATCATTCACTGTGATCTAAAACCTGAAAATATCCTTCTTTGTAACCCCAAACGC
AGTGCAATCAAGATAGTTGACTTTGGCAGTTCTTGTCAGTTGGGGCAGAGGATATACCAG
TATATTCAGAGTCGCTTTTATCGGTCTCCAGAGGTGCTACTGGGAATGCCTTATGACCTT
GCCATTGATATGTGGTCCCTCGGGTGTATTTTGGTTGAAATGCACACTGGAGAACCTCTG
TTCAGTGGTGCCAATGAGGTAGATCAGATGAATAAAATAGTGGAAGTTCTGGGTATTCCA
CCTGCTCATATTCTTGACCAAGCACCAAAAGCAAGAAAGTTCTTTGAGAAGTTGCCAGAT
GGCACTTGGAACTTAAAGAAGACCAAAGATGGAAAACGGGAGTACAAACCACCAGGAACC
CGTAAACTTCATAACATTCTTGGAGTGGAAACAGGAGGACCTGGTGGGCGACGTGCTGGG
GAGTCAGGTCATACGGTCGCTGACTACTTGAAGTTCAAAGACCTCATTTTAAGGATGCTT
GATTATGACCCCAAAACTCGAATTCAACCTTATTATGCTCTGCAGCACAGTTTCTTCAAG
AAAACAGCTGATGAAGGTACAAATACAAGTAATAGTGTATCTACAAGCCCCGCCATGGAG
CAGTCTCAGTCTTCGGGCACCACCTCCAGTACATCGTCAAGCTCAGGTGGCTCATCGGGG
ACAAGCAACAGTGGGAGAGCCCGGTCGGATCCGACGCACCAGCATCGGCACAGTGGTGGG
CACTTCACAGCTGCCGTGCAGGCCATGGACTGCGAGACACACAGTCCCCAGGTGAGCTCG
CACGTGGTTCATTTGCTTGTGTCACCTGCCATTCTCAGGTGGAGCAGCACTGGATGCCAG
GTGCCTTTAGAATGA
Restriction Sites Please inquire     
ACCN NM_101395
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_101395.1, NP_567824.1
RefSeq Size 5315 bp
RefSeq ORF 1755 bp
Locus ID 1859
UniProt ID Q13627
Cytogenetics 21q22.13
Protein Families Druggable Genome, Protein Kinase
Gene Summary This gene encodes a member of the Dual-specificity tyrosine phosphorylation-regulated kinase (DYRK) family. This member contains a nuclear targeting signal sequence, a protein kinase domain, a leucine zipper motif, and a highly conservative 13-consecutive-histidine repeat. It catalyzes its autophosphorylation on serine/threonine and tyrosine residues. It may play a significant role in a signaling pathway regulating cell proliferation and may be involved in brain development. This gene is a homolog of Drosophila mnb (minibrain) gene and rat Dyrk gene. It is localized in the Down syndrome critical region of chromosome 21, and is considered to be a strong candidate gene for learning defects associated with Down syndrome. Alternative splicing of this gene generates several transcript variants differing from each other either in the 5' UTR or in the 3' coding region. These variants encode at least five different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) is alternatively spliced in the 5' UTR and in the 3' coding region, as compared to variant 1. It encodes a 179 aa shorter isoform which lacks the poly-His domain and has a different C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.