QK1 (QKI) (NM_206854) Human Untagged Clone

CAT#: SC308286

QKI (untagged)-Human quaking homolog, KH domain RNA binding (mouse) (QKI), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: QK1
• Synonyms: Hqk; hqkI; QK; QK1; QK3
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_206854 edited
  ATGGTCGGGGAAATGGAAACGAAGGAGAAGCCGAAGCCCACCCCAGATTACCTGATGCAG
  CTGATGAACGACAAGAAGCTCATGAGCAGCCTGCCCAACTTCTGCGGGATCTTCAACCAC
  CTCGAGCGGCTGCTGGACGAAGAAATTAGCAGAGTACGGAAAGACATGTACAATGACACA
  TTAAATGGCAGTACAGAGAAAAGGAGTGCAGAATTGCCTGATGCTGTGGGACCTATTGTT
  CAGTTACAAGAGAAACTTTATGTGCCTGTAAAAGAATACCCAGATTTTAATTTTGTTGGG
  AGAATCCTTGGACCTAGAGGACTTACAGCCAAACAACTTGAAGCAGAAACCGGATGTAAA
  ATCATGGTCCGAGGCAAAGGCTCAATGAGGGATAAAAAAAAGGAGGAGCAAAATAGAGGC
  AAGCCCAATTGGGAGCATCTAAATGAAGATTTACATGTACTAATCACTGTGGAAGATGCT
  CAGAACAGAGCAGAAATCAAATTGAAGAGAGCAGTTGAAGAAGTGAAGAAATTATTGGTA
  CCTGCAGCAGAAGGAGAAGACAGCCTGAAGAAGATGCAGCTGATGGAGCTTGCGATTCTG
  AATGGCACCTACAGAGATGCCAACATTAAATCACCAGCCCTTGCCTTTTCTCTTGCAGCA
  ACAGCCCAGGCTGCTCCAAGGATCATTACTGGGCCTGCGCCGGTTCTCCCACCAGCTGCC
  CTGCGTACTCCTACGCCAGCTGGCCCTACCATAATGCCTTTGATCAGACAAATACAGACC
  GCTGTCATGCCAAACGGAACTCCTCACCCAACTGCTGCAATAGTTCCTCCAGGGCCCGAA
  GCTGGTTTAATCTATACACCCTATGAGTACCCCTACACATTGGCACCAGCTACATCAATC
  CTTGAGTATCCTATTGAACCTAGTGGTGTATTAGAGTGGATTGAAATGCCAGTCATGCCT
  GATATTTCAGCCCATTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_206854
• Insert Size: 1000 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_206854.1.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_206854.1, NP_996736.1
• RefSeq Size: 6972 bp
• RefSeq ORF: 978 bp
• Locus ID: 9444
• UniProt ID: Q96PU8
• Cytogenetics: 6q26
• Gene Summary: The protein encoded by this gene is an RNA-binding protein that regulates pre-mRNA splicing, export of mRNAs from the nucleus, protein translation, and mRNA stability. The encoded protein is involved in myelinization and oligodendrocyte differentiation and may play a role in schizophrenia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (3) differs in the 3' UTR and coding region compared to variant 1, which results in a frameshift. The resulting isoform (3; also known as HQK-7 and QKI-7) is shorter and has a distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.