Pit1 (POU1F1) (NM_000306) Human Untagged Clone

CAT#: SC300043

POU1F1 (untagged)-Human POU class 1 homeobox 1 (POU1F1), transcript variant alpha

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Pit1
• Synonyms: CPHD1; GHF-1; Pit-1; PIT1; POU1F1a
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC300043 representing NM_000306.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAGTTGCCAAGCTTTTACTTCGGCTGATACCTTTATACCTCTGAATTCTGACGCCTCTGCAACTCTG
  CCTCTGATAATGCATCACAGTGCTGCCGAGTGTCTACCAGTCTCCAACCATGCCACCAATGTGATGTCT
  ACAGCAACAGGACTTCATTATTCTGTTCCTTCCTGTCATTATGGAAACCAGCCATCAACCTATGGAGTG
  ATGGCAGGTAGTTTAACCCCTTGTCTTTATAAATTTCCTGACCACACCTTGAGTCATGGATTTCCTCCT
  ATACACCAGCCTCTTCTGGCAGAGGACCCCACAGCTGCTGATTTCAAGCAGGAACTCAGGCGGAAAAGT
  AAATTGGTGGAAGAGCCAATAGACATGGATTCTCCAGAAATCAGAGAACTTGAAAAGTTTGCCAATGAA
  TTTAAAGTGAGACGAATTAAATTAGGATACACCCAGACAAATGTTGGGGAGGCCCTGGCAGCTGTGCAT
  GGCTCTGAATTCAGTCAAACAACAATCTGCCGATTTGAAAATCTGCAGCTCAGCTTTAAAAATGCATGC
  AAACTGAAAGCAATATTATCCAAATGGCTGGAGGAAGCTGAGCAAGTAGGAGCTTTGTACAATGAAAAA
  GTGGGAGCAAATGAAAGGAAAAGAAAACGAAGAACAACTATAAGCATTGCTGCTAAAGATGCTCTGGAG
  AGACACTTTGGAGAACAGAATAAACCTTCTTCTCAAGAGATCATGAGGATGGCTGAAGAACTGAATCTG
  GAGAAAGAAGTAGTAAGAGTTTGGTTTTGCAACCGGAGGCAGAGAGAAAAACGGGTGAAAACAAGTCTG
  AATCAGAGTTTATTTTCTATTTCTAAGGAACATCTTGAGTGCAGATAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_000306
• Insert Size: 876 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_000306.3
• RefSeq Size: 1262 bp
• RefSeq ORF: 876 bp
• Locus ID: 5449
• UniProt ID: P28069
• Cytogenetics: 3p11.2
• Protein Families: Druggable Genome, Transcription Factors
• MW: 32.9 kDa
• Gene Summary: This gene encodes a member of the POU family of transcription factors that regulate mammalian development. The protein regulates expression of several genes involved in pituitary development and hormone expression. Mutations in this genes result in combined pituitary hormone deficiency. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (alpha) uses an alternate in-frame splice site in the 5' coding region, compared to variant beta, resulting in a shorter protein (isoform alpha).