OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home cDNA Clone miRNA MicroRNA Plasmid

MIR29B-2 (MI0000107) MicroRNA

Specifications Citations (1) Related Products Product Documents
SKU ACCN Description Price Availability
SC400311 MI0000107 Expression plasmid for human microRNA MIR29B-2 $330 In Stock
       Add to Cart

Also for MIR29B-2 (MI0000107)

OriGene TrueClone Data
Vector:pCMV-MIR
Sequence Data:
(Full insert)
Precursor:CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUC
UAGCACCAUUUGAAAUCAGUGUUUUAGGAG
Mature Sequence:CUGGUUUCACAUGGUGGCUUAG
OTI Disclaimer:All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA
Product Components:The plasmid is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Also Contains:
Both mature and minor (star) miRNA can be over expressed from the construct.

Reference Data
RefSeq: MI0000107,
Synonyms : MIRN29B2 mir-29b-2
Locus ID: 407025
Summary:

 

Inc 5000 Healthcare Company