OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home cDNA Clone miRNA MicroRNA Plasmid

MIR219-1 (MI0000296) MicroRNA

Specifications Citations (1) Related Products Product Documents
SKU ACCN Description Price Availability
SC400284 MI0000296 Expression plasmid for human microRNA MIR219-1 $330 In Stock
       Add to Cart

Also for MIR219-1 (MI0000296)

OriGene TrueClone Data
Vector:pCMV-MIR
Sequence Data:
(Full insert)
Precursor:CCGCCCCGGGCCGCGGCUCCUGAUUGUCCAAACGCAAUUCUCGAGUCUAUG
GCUCCGGCCGAGAGUUGAGUCUGGACGUCCCGAGCCGCCGCCCCCAAACCU
CGAGCGGG
Mature Sequence:UGAUUGUCCAAACGCAAUUCU
OTI Disclaimer:All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA
Product Components:The plasmid is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Also Contains:
Both mature and minor (star) miRNA can be over expressed from the construct.

Reference Data
RefSeq: MI0000296,
Synonyms : mir-219 MRI219-1 MIRN219-1
Locus ID: 407002
Summary:

 

Inc 5000 Healthcare Company