OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home CRISPR-CAS9 KN313675

Pparg - mouse gene knockout kit via CRISPR

divider

Specifications  Citations  Validation Data  FAQ
SKU Description Price Availability Manual  
KN313675 Pparg - mouse gene knockout kit via CRISPR $1200 4 weeks Manual PDF Add to Shopping Cart
spacer
Also for Pparg (Locus ID 19016)
cDNA Clone shRNA/siRNA CRISPR KO Kit Protein Request Antibody
SKU Description Donor Vector Price Availability  
KN313675RB Pparg - mouse gene knockout kit via CRISPR RFP-BSD 1290 4 weeks
KN313675LP Pparg - mouse gene knockout kit via CRISPR Luciferase-Puro 1290 4 Weeks
KN313675BN Pparg - mouse gene knockout kit via CRISPR mBFP-Neo 1290 4 Weeks
Add to Shopping Cart

Comparing to KN313675, the above kits contain:

  • Identical gRNA vectors
  • Identical LHA & RHA
  • Different donor cassette
kn_donor_diagram
Kit Components
KN313675G1, Pparg gRNA vector 1 in pCas-Guide vector, Target Sequence: AGTGGTCTTCCATCACGGAG
KN313675G2, Pparg gRNA vector 2 in pCas-Guide vector, Target Sequence: GAGCTGATTCCGAAGTTGGT
KN313675D, donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
Homologous arm and GFP-puro sequences   
GE100003, scramble sequence in pCas-Guide vector

Disclaimer
The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data
RefSeq: BC021798NM_001127330NM_001308352NM_001308354NM_011146
Synonyms: Nr1c3; PPAR-gamma; PPAR-gamma2; PPARgamma; PPARgamma2
Summary: This gene encodes a nuclear receptor protein belonging to the peroxisome proliferator-activated receptor (Ppar) family. The encoded protein is a ligand-activated transcription factor that is involved in the regulation of adipocyte differentiation and glucose homeostasis. The encoded protein forms a heterodimer with retinoid X receptors and binds to DNA motifs termed 'peroxisome proliferator response elements' to either activate or inhibit gene expression. Mice lacking the encoded protein die at an embryonic stage due to severe defects in placental vascularization. When the embryos lacking this gene are supplemented with healthy placentas, the mutants survive to term, but succumb to lipodystrophy and multiple hemorrhages. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015].

Learn more about CRISPR?

Diagram-Gene Editing RecombII


 

pattern
Inc 5000 Healthcare Company