OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home CRISPR-CAS9 KN312748

Padi4 - mouse gene knockout kit via CRISPR

divider

Specifications  Citations  Validation Data  FAQ
SKU Description Price Availability Manual  
KN312748 Padi4 - mouse gene knockout kit via CRISPR $1200 7 Days * Manual PDF Add to Shopping Cart

* Business Days

spacer
Also for Padi4 (Locus ID 18602)
cDNA Clone shRNA/siRNA CRISPR KO Kit Protein Request Antibody
SKU Description Donor Vector Price Availability  
KN312748RB Padi4 - mouse gene knockout kit via CRISPR RFP-BSD 1290 7 Days
KN312748LP Padi4 - mouse gene knockout kit via CRISPR Luciferase-Puro 1290 4 Weeks
KN312748BN Padi4 - mouse gene knockout kit via CRISPR mBFP-Neo 1290 4 Weeks
Add to Shopping Cart

Comparing to KN312748, the above kits contain:

  • Identical gRNA vectors
  • Identical LHA & RHA
  • Different donor cassette
kn_donor_diagram
Kit Components
KN312748G1, Padi4 gRNA vector 1 in pCas-Guide vector, Target Sequence: CACGTGGATCACCGCGCCTT
KN312748G2, Padi4 gRNA vector 2 in pCas-Guide vector, Target Sequence: CACCACACACACGGCGTGAG
KN312748D, donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
Homologous arm and GFP-puro sequences   
GE100003, scramble sequence in pCas-Guide vector

Disclaimer
The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data
RefSeq: NM_011061
Synonyms: Pad4; Pdi4
Summary:

Learn more about CRISPR?

Diagram-Gene Editing RecombII


 

pattern
Inc 5000 Healthcare Company