OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home CRISPR-CAS9 KN216939

CD22 - human gene knockout kit via CRISPR

divider

Specifications  Citations  Validation Data  FAQ
SKU Description Price Availability Manual  
KN216939 CD22 - human gene knockout kit via CRISPR $1200 4 Weeks Manual PDF Add to Shopping Cart
spacer
SKU Description Donor Vector Price Availability  
KN216939RB CD22 - human gene knockout kit via CRISPR RFP-BSD 1290 4 Weeks
KN216939LP CD22 - human gene knockout kit via CRISPR Luciferase-Puro 1290 4 Weeks
KN216939BN CD22 - human gene knockout kit via CRISPR mBFP-Neo 1290 4 Weeks
Add to Shopping Cart

Comparing to KN216939, the above kits contain:

  • Identical gRNA vectors
  • Identical LHA & RHA
  • Different donor cassette
kn_donor_diagram
Kit Components
KN216939G1, CD22 gRNA vector 1 in pCas-Guide vector, Target Sequence: CTGTGGCCTGGGCTAGTACT
KN216939G2, CD22 gRNA vector 2 in pCas-Guide vector, Target Sequence: TGGGCTAGTACTGGGGTTCT
KN216939D, donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
Homologous arm and GFP-puro sequences   
GE100003, scramble sequence in pCas-Guide vector

Disclaimer
The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data
RefSeq: NM_001185099NM_001185100NM_001185101NM_001278417NM_001771
Synonyms: SIGLEC-2; SIGLEC2
Summary: Mediates B-cell B-cell interactions. May be involved in the localization of B-cells in lymphoid tissues. Binds sialylated glycoproteins; one of which is CD45. Preferentially binds to alpha-2,6-linked sialic acid. The sialic acid recognition site can be masked by cis interactions with sialic acids on the same cell surface. Upon ligand induced tyrosine phosphorylation in the immune response seems to be involved in regulation of B-cell antigen receptor signaling. Plays a role in positive regulation through interaction with Src family tyrosine kinases and may also act as an inhibitory receptor by recruiting cytoplasmic phosphatases via their SH2 domains that block signal transduction through dephosphorylation of signaling molecules. [UniProtKB/Swiss-Prot Function]

Learn more about CRISPR?

Diagram-Gene Editing RecombII


 

pattern
Inc 5000 Healthcare Company