OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home CRISPR-CAS9 KN211372

NRG1 - human gene knockout kit via CRISPR

divider

Specifications  Citations  Validation Data  FAQ
SKU Description Price Availability Manual  
KN211372 NRG1 - human gene knockout kit via CRISPR $1200 7 Days * Manual PDF Add to Shopping Cart

* Business Days

spacer
SKU Description Donor Vector Price Availability  
KN211372RB NRG1 - human gene knockout kit via CRISPR RFP-BSD 1290 4 Weeks
KN211372LP NRG1 - human gene knockout kit via CRISPR Luciferase-Puro 1290 4 Weeks
KN211372BN NRG1 - human gene knockout kit via CRISPR mBFP-Neo 1290 4 Weeks
Add to Shopping Cart

Comparing to KN211372, the above kits contain:

  • Identical gRNA vectors
  • Identical LHA & RHA
  • Different donor cassette
kn_donor_diagram
Kit Components
KN211372G1, NRG1 gRNA vector 1 in pCas-Guide vector, Target Sequence: CCGCGCCGCTCCGGGCGTCC
KN211372G2, NRG1 gRNA vector 2 in pCas-Guide vector, Target Sequence: CAGCGGCGGCGACGAGCGGG
KN211372D, donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
Homologous arm and GFP-puro sequences   
GE100003, scramble sequence in pCas-Guide vector

Disclaimer
The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data
RefSeq: AF009227NM_001159995NM_001159996NM_001159999NM_001160001NM_001160002NM_001160004NM_001160005NM_001160007NM_001160008NM_001322197NM_001322201NM_001322202NM_001322205NM_001322206NM_001322207NM_004495NM_013956NM_013957NM_013958NM_013959NM_013960NM_013961NM_013962NM_013964XM_005273486XM_005273487XM_006716335XM_011544512XM_017013365XM_017013366XM_017013367XM_017013368XM_017013369XM_017013370XM_017013371XM_017013372
Synonyms: ARIA; GGF; GGF2; HGL; HRG; HRG1; HRGA; MST131; MSTP131; NDF; NRG1-IT2; SMDF
Summary: The protein encoded by this gene is a membrane glycoprotein that mediates cell-cell signaling and plays a critical role in the growth and development of multiple organ systems. An extraordinary variety of different isoforms are produced from this gene through alternative promoter usage and splicing. These isoforms are expressed in a tissue-specific manner and differ significantly in their structure, and are classified as types I, II, III, IV, V and VI. Dysregulation of this gene has been linked to diseases such as cancer, schizophrenia, and bipolar disorder (BPD). [provided by RefSeq, Apr 2016].

Learn more about CRISPR?

Diagram-Gene Editing RecombII


 

pattern
Inc 5000 Healthcare Company