OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home CRISPR-CAS9 KN216220

TRPM2 - human gene knockout kit via CRISPR

divider

Specifications  Citations (1)  Validation Data  FAQ
SKU Description Price Availability Manual  
KN216220 TRPM2 - human gene knockout kit via CRISPR $1200 7 Days * Manual PDF Add to Shopping Cart

* Business Days

spacer
SKU Description Donor Vector Price Availability  
KN216220RB TRPM2 - human gene knockout kit via CRISPR RFP-BSD 1290 4 Weeks
KN216220LP TRPM2 - human gene knockout kit via CRISPR Luciferase-Puro 1290 4 Weeks
KN216220BN TRPM2 - human gene knockout kit via CRISPR mBFP-Neo 1290 4 Weeks
Add to Shopping Cart

Comparing to KN216220, the above kits contain:

  • Identical gRNA vectors
  • Identical LHA & RHA
  • Different donor cassette
kn_donor_diagram
Kit Components
KN216220G1, TRPM2 gRNA vector 1 in pCas-Guide vector, Target Sequence: GGAGATTGGAGACCATCCCC
KN216220G2, TRPM2 gRNA vector 2 in pCas-Guide vector, Target Sequence: GAGGAAAGCTGGCTCGGAGC
KN216220D, donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
Homologous arm and GFP-puro sequences   
GE100003, scramble sequence in pCas-Guide vector

Disclaimer
The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data
RefSeq: NM_001001188NM_003307NR_038257XM_005261171XM_011529736XM_017028456XM_017028457XR_001754900XR_001754901XR_001754902
Synonyms: EREG1; KNP3; LTrpC-2; LTRPC2; NUDT9H; NUDT9L1; TRPC7
Summary: The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]

Learn more about CRISPR?

Diagram-Gene Editing RecombII


 

pattern
Inc 5000 Healthcare Company