OriGene Logo
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
Home CRISPR-CAS9 KN209079

KIF17 - human gene knockout kit via CRISPR


Specifications  Citations (1)  Validation Data  FAQ
SKU Description Price Availability Manual  
KN209079 KIF17 - human gene knockout kit via CRISPR $1200 4 Weeks Manual PDF Add to Shopping Cart
Also for KIF17 (Locus ID 57576)
cDNA Clone shRNA/siRNA CRISPR KO Kit Protein Request Antibody
SKU Description Donor Vector Price Availability  
KN209079RB KIF17 - human gene knockout kit via CRISPR RFP-BSD 1290 4 Weeks
KN209079LP KIF17 - human gene knockout kit via CRISPR Luciferase-Puro 1290 4 Weeks
KN209079BN KIF17 - human gene knockout kit via CRISPR mBFP-Neo 1290 4 Weeks
Add to Shopping Cart

Comparing to KN209079, the above kits contain:

  • Identical gRNA vectors
  • Identical LHA & RHA
  • Different donor cassette
Kit Components
KN209079G1, KIF17 gRNA vector 1 in pCas-Guide vector, Target Sequence: GACAACCTTCACCGCCTCGG
KN209079G2, KIF17 gRNA vector 2 in pCas-Guide vector, Target Sequence: TCTCGCTCCCGCTGGTTCAT
KN209079D, donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
Homologous arm and GFP-puro sequences   
GE100003, scramble sequence in pCas-Guide vector

The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data
RefSeq: NM_001122819NM_001287212NM_020816XM_005245950XM_005245951XM_011541837XM_011541838XM_011541839XM_011541840XM_011541841XM_011541842XM_011541843XM_011541844XM_011541845XM_011541846XM_011541847XM_027915XR_241202
Synonyms: KIAA1405; KIF17B; KIF3X; KIF17 variant protein; KIF3-related motor protein; OTTHUMP00000179076; kinesin-like protein KIF17; kinesin family member 17

Learn more about CRISPR?

Diagram-Gene Editing RecombII


Inc 5000 Healthcare Company