OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home CRISPR-CAS9 KN204066

FOXA2 - human gene knockout kit via CRISPR

divider

Specifications  Citations (1)  Validation Data  FAQ
SKU Description Price Availability Manual  
KN204066 FOXA2 - human gene knockout kit via CRISPR $1200 7 Days * Manual PDF Add to Shopping Cart

* Business Days

spacer
SKU Description Donor Vector Price Availability  
KN204066RB FOXA2 - human gene knockout kit via CRISPR RFP-BSD 1290 7 Days
KN204066LP FOXA2 - human gene knockout kit via CRISPR Luciferase-Puro 1290 4 Weeks
KN204066BN FOXA2 - human gene knockout kit via CRISPR mBFP-Neo 1290 4 Weeks
Add to Shopping Cart

Comparing to KN204066, the above kits contain:

  • Identical gRNA vectors
  • Identical LHA & RHA
  • Different donor cassette
kn_donor_diagram
Kit Components
KN204066G1, FOXA2 gRNA vector 1 in pCas-Guide vector, Target Sequence: AAGGGCACGAGCCGTCCGAC
KN204066G2, FOXA2 gRNA vector 2 in pCas-Guide vector, Target Sequence: CACTCGGCTTCCAGTATGCT
KN204066D, donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
Homologous arm and GFP-puro sequences   
GE100003, scramble sequence in pCas-Guide vector

Disclaimer
The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data
RefSeq: NM_021784NM_153675
Synonyms: HNF3B; TCF3B
Summary: This gene encodes a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators for liver-specific genes such as albumin and transthyretin, and they also interact with chromatin. Similar family members in mice have roles in the regulation of metabolism and in the differentiation of the pancreas and liver. This gene has been linked to sporadic cases of maturity-onset diabetes of the young. Transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008].

Learn more about CRISPR?

Diagram-Gene Editing RecombII


 

pattern
Inc 5000 Healthcare Company