OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home CRISPR-CAS9 KN200003

TP53 - human gene knockout kit via CRISPR

divider

Specifications  Citations (1)  Validation Data  FAQ
SKU Description Price Availability Manual  
KN200003 TP53 - human gene knockout kit via CRISPR $1200 7 Days * Manual PDF Add to Shopping Cart

* Business Days

spacer
SKU Description Donor Vector Price Availability  
KN200003RB TP53 - human gene knockout kit via CRISPR RFP-BSD 1290 7 Days
KN200003LP TP53 - human gene knockout kit via CRISPR Luciferase-Puro 1290 4 Weeks
KN200003BN TP53 - human gene knockout kit via CRISPR mBFP-Neo 1290 4 Weeks
Add to Shopping Cart

Comparing to KN200003, the above kits contain:

  • Identical gRNA vectors
  • Identical LHA & RHA
  • Different donor cassette
kn_donor_diagram
Kit Components
KN200003G1, TP53 gRNA vector 1 in pCas-Guide vector, Target Sequence: TCGACGCTAGGATCTGACTG
KN200003G2, TP53 gRNA vector 2 in pCas-Guide vector, Target Sequence: CTGTGAGTGGATCCATTGGA
KN200003D, donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
Homologous arm and GFP-puro sequences   
GE100003, scramble sequence in pCas-Guide vector

Disclaimer
The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data
RefSeq: NM_000546NM_001126112NM_001126113NM_001126114NM_001126115NM_001126116NM_001126117NM_001126118NM_001276695NM_001276696NM_001276697NM_001276698NM_001276699NM_001276760NM_001276761
Synonyms: BCC7; LFS1; P53; TRP53
Summary: This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons from identical transcript variants (PMIDs: 12032546, 20937277). [provided by RefSeq, Dec 2016]

Learn more about CRISPR?

Diagram-Gene Editing RecombII


 

pattern
Inc 5000 Healthcare Company