OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 

Useful Links

Browse by Family/Pathways

Webinars

spacer
Home cDNA Clone miRNA MicroRNA Plasmid

MIR126 (MI0000471) MicroRNA

Specifications Citations (1) Related Products Product Documents
SKU ACCN Description Price Availability
SC400085 MI0000471 Expression plasmid for human microRNA MIR126 $330 In Stock
       Add to Cart

Also for MIR126 (MI0000471)

OriGene TrueClone Data
Vector:pCMV-MIR
Sequence Data:
(Full insert)
Precursor:CGCUGGCGACGGGACAUUAUUACUUUUGGUACGCGCUGUGACACUUCAAAC
UCGUACCGUGAGUAAUAAUGCGCCGUCCACGGCA
Mature Sequence:CAUUAUUACUUUUGGUACGCG
OTI Disclaimer:All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA
Product Components:The plasmid is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Also Contains:
Both mature and minor (star) miRNA can be over expressed from the construct.

Reference Data
RefSeq: MI0000471,
Synonyms : MIRN126 miRNA126
Locus ID: 406913
Summary:

 

Inc 5000 Healthcare Company
View topsellers by:   Title | Price | Category | Popularity | Best Sellers Popular items by:   Popularity | Our Choices | All-Round Favorites | Title
View products by:   Title | Price | Category | Popularity | Best Sellers
Previous:  MIR1255B-1 (MI0006435) MicroRNA - MicroRNA Plasmid - miRNA - cDNA Clone
Next:  MIR1260 (MI0006394) MicroRNA - MicroRNA Plasmid - miRNA - cDNA Clone