MIR7114 Human MicroRNA Expression Plasmid (MI0022965)

CAT#: SC402350

Reviews ()
Write a review

Expression Plasmid of Human microRNA MIR7114



USD 360.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Species Human
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
Precursor:
UCCGCUCUGUGGAGUGGGGUGCCUGUCCCCUGCCACUGGGUGACCCACCCCUCUCCACCAG
Mature Sequence:
UCUGUGGAGUGGGGUGCCUGU
>MI0022965 GGGGAGATCAAGGGGAAGAAGCGTGGCCGGGGGATGAAGACCAAAACTACCTCCCACGCATGTGCGTGGGTGCATGTGTGTCGGAGAGGGGGAGGAAGGAGGAGCAGATGCCTGACCACAGCTTCTTACAGGGAGGTCCTGGACACCTCTATCTCCTCAAGAACAAGGTGGCCACCTTTGCCAAAGTGGAGAAGGAAGAGGACATGATTCAGTGAGAAGCCGGGTGCCCTGGGCGCGGGGAGGGCTGGAGGCAGAGTCCAGGCCCTGGCATGTCCCTCCCCCACAGCCCCTCCTCCACGGTCCGCTCTGTGGAGTGGGGTGCCTGTCCCCTGCCACTGGGTGACCCACCCCTCTCCACCAGCTTCTGGAAGCGGCTGAGCCGCCTGATGAGCAAAGTGAACCCAGAGCCGAACGTCATCCACATCATGGGCTGCTACATTCTGGGGAACCCCAATGGAGAGAAGGTACAGTGACCCCCAAGCCCCACCCCAGACCTCTGGAAACCCCCGACGTGGACAGACAGGGCAGAGCCTTCCATGTTTCCTGGCATTTTTTTTCCTTCCCCCGGGCATTCCCCTAGAAATCCTTTATGCCTGAGCCCAGCCAGGTTTGGGGGGTCTGAAAAAAGAGGGTGGGCCCTGCTCCCCATCTCCTCCCCGCT
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Product Components The plasmid is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
Reference Data
RefSeq MI0022965
Other products for "MIR7114"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools