MIR3547 Rat qPCR Template Standard (MI0015401)
Specifications
| Product Data | |
| Recommended Application | Plasmid of exact quantity for transcript copy number calculation |
|---|---|
| Forward Sequence | TGAGCACCACCCCTCTCTCA |
| Reverse Sequence | GAACATGTCTGCGTATCTC |
| ACCN | MIMAT0017802 |
| Synonyms | MI0015401; MIMAT0017802; MIR3547 rno-mir-3547; rno-miR-3547 |
| Components | 1 vial of lyophilized SybGREEN qPCR miRNA primer mix (1 nmol each primer, sufficient for 200 reactions), 1 vial lyophilized qPCR miRNA template standard: 50 X 10^7 copies (100 reactions) |
| Quality Control | Each standard is generated using qSTAR miRNA primer pairs and sequence-verified prior to shipment |
| Storage | The primer mix and template standard are stable for one year from date of shipping. Store at -20°C. |
| Shipping | Blue Ice |
Reviews
Documents
| Product Manuals |
| FAQs |
Resources
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.