MIR3152 Human qPCR Template Standard (MI0014179)

CAT#: HK300759

Reviews ()
Write a review

MIR3152 (Human) qSTAR miRNA primer pairs + Copy number standard kit

USD 300.00


Availability*
2 Weeks

Size
    • 200 reactions

Product images

Specifications

Product Data
Application Plasmid of exact quantity for transcript copy number calculation
Forward Sequence ATTGCCTCTGTTCTAACACA
Reverse Sequence GAACATGTCTGCGTATCTC
Accession No MIMAT0019207
Synonyms hsa-miR-3152-5p; MI0014179; MIMAT0019207; MIR3152 hsa-mir-3152
Components 1 vial of lyophilized SybGREEN qPCR miRNA primer mix (1 nmol each primer, sufficient for 200 reactions), 1 vial lyophilized qPCR miRNA template standard: 50 X 10^7 copies (100 reactions)
Quality Control Each standard is generated using qSTAR miRNA primer pairs and sequence-verified prior to shipment
Storage & Stability The primer mix and template standard are stable for one year from date of shipping. Store at -20°C.
Other products for "MIR3152"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
BOGO Free lysates
68 Mouse Clones