MIR7-2 Human qPCR Template Standard (MI0000264)

CAT#: HK300674

MIR7-2 (Human) qSTAR miRNA primer pairs + Copy number standard kit



SensiMix SYBR Master Mix

USD 389.00

2 Weeks*

Size
    • 200 reactions

Product Images

Other products for "MIR7-2"

Specifications

Product Data
Application Plasmid of exact quantity for transcript copy number calculation
Forward Sequence TGGAAGACTAGTGATTTTGTT
Reverse Sequence GAACATGTCTGCGTATCTC
Accession No MIMAT0000252
Synonyms hsa-miR-7; MI0000264; MIMAT0000252; MIR7-2 hsa-mir-7-2
Components 1 vial of lyophilized SybGREEN qPCR miRNA primer mix (1 nmol each primer, sufficient for 200 reactions), 1 vial lyophilized qPCR miRNA template standard: 50 X 10^7 copies (100 reactions)
Quality Control Each standard is generated using qSTAR miRNA primer pairs and sequence-verified prior to shipment
Storage The primer mix and template standard are stable for one year from date of shipping. Store at -20°C.

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.