Thumpd3 Mouse qPCR Primer Pair (NM_008188)

CAT#: MP221449

Reviews ()
Write a review

qSTAR qPCR primer pairs against mus musculus gene Thumpd3



SensiMix SYBR Master Mix

USD 120.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 14911
Forward Sequence CTCCAATGAGGCTGCGAGAGAT
Reverse Sequence GGAGACTCTCTTCTGTCAGTGC
Accession No BC002024, BC012688, BC046800, NM_008188, NM_001355266, NM_008188.3
Synonyms AW556087; Gt(ROSA)26asSor; Gtrosa26as
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "Thumpd3"
Frequently bought together (3)
Thumpd3 (Myc-DDK-tagged) - Mouse THUMP domain containing 3 (Thumpd3)
    • 10 ug

USD 480.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

USD 140.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 440.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools