Ppp2r2b Mouse qPCR Primer Pair (NM_028392)

CAT#: MP220748

Reviews ()
Write a review

qSTAR qPCR primer pairs against mus musculus gene Ppp2r2b

USD 100.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 72930
Forward Sequence AGTCAGTGAGCGGGATAAGAGG
Reverse Sequence GCATTGGCAAACACTCTTCGTGG
Accession No BC026686, BC088979, NM_027531, NM_028392, NR_073583, BB694259, BC066007, BC085147, BY125586
Synonyms 2900026H06Rik; 6330404L05Rik; E130009M08Rik; PP2A-PR55B; PR55-BETA; SCA12
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "Ppp2r2b"
Frequently bought together (1)
Ppp2r2b (Myc-DDK-tagged) - Mouse protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform (Ppp2r2b), transcript variant 2
    • 10 ug

USD 68.00 USD 269.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones