AAdacl4fm3 Mouse qPCR Primer Pair (NM_001085536)

CAT#: MP219631

Reviews ()
Write a review

qSTAR qPCR primer pairs against Mus musculus gene Gm13178



SensiMix SYBR Master Mix

USD 132.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 546849
Forward Sequence AGGTGCCGTATGTGGAAGTCTG
Reverse Sequence GAAGTGGATGGAAGCATTCAGGC
Accession No NM_001085536, NM_001085536.1, NM_001085536.2
Synonyms Gm437; OTTMUSG00000010750
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "Gm13178"
Frequently bought together (4)
Gm13178 Antibody - C-terminal region
    • 100 ul

USD 475.00


Gm13178 (Myc-DDK-tagged) - Mouse predicted gene 13178 (Gm13178)
    • 10 ug

USD 398.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

USD 154.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 484.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.