Lgals3bp Mouse qPCR Primer Pair (NM_011150)

CAT#: MP207334

Reviews ()
Write a review

qSTAR qPCR primer pairs against Mus musculus gene Lgals3bp

USD 120.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 19039
Forward Sequence ATGCCTGTCGTCAGAGACTTCC
Reverse Sequence GGCAAAAAGCCGTCCACAGTAG
Accession No BC090658, NM_011150
Synonyms 90K; CyCAP; MAC-2BP; Ppicap; Tango10b
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "Lgals3bp"
Frequently bought together (1)
Lgals3bp (Myc-DDK-tagged) - Mouse lectin, galactoside-binding, soluble, 3 binding protein (Lgals3bp)
    • 10 ug

USD 610.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones