MIR6511b-2 Human qPCR Primer Pair (MI0023431)

CAT#: HP301305

Reviews ()
Write a review

MIR6511b-2 (Human) qSTAR miRNA primer pairs - 200 reactions

USD 130.00


Availability*
3 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Forward Sequence CTGCAGGCAGAAGTGGGGCTG
Reverse Sequence GAACATGTCTGCGTATCTC
Accession No MIMAT0025847
Synonyms hsa-miR-6511b-5p; MI0023431; MIMAT0025847; MIR6511b-2 hsa-mir-6511b-2
Component 1 vial of lyophilized qSTAR miRNA primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been pre-validated on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "MIR6511b-2"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
BOGO Free lysates
68 Mouse Clones