Germany
Japan
United Kingdom
China
SARS-CoV-2 (COVID-19) qPCR Primer Pair RdRp
CAT#: HP234774
qSTAR qPCR primer pairs against SARS-CoV-2 (COVID-19) RdRp gene
SensiMix SYBR Master Mix
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
mRFP-tagged ORF clone for SARS-CoV-2 NSP5 [Severe acute respiratory syndrome coronavirus 2], YP_009725301.1
USD 300.00
Other products for "3C-like Proteinase"
Specifications
| Product Data | |
| Gene ID | 43740578 |
| Forward Sequence | acgctcaaagctactgaggagac |
| Reverse Sequence | ggtctaggtttaccaacttccc |
| Accession No | NC_045512.2 |
| Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.