CD59 Human qPCR Primer Pair (NM_203330)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
CD59 (Myc-DDK-tagged)-Human CD59 molecule, complement regulatory protein (CD59), transcript variant 2
USD 225.00
Other products for "CD59"
Specifications
Product Data | |
Gene ID | 966 |
Forward Sequence | TGATGCGTGTCTCATTACCAAAGC |
Reverse Sequence | ACACAGGTCCTTCTTGCAGCAG |
Accession No | NM_203330, NM_203330.1, NM_203330.2, BC001506, BC001506.2, BC033226, BE899630, BG284181, BI752924, BM457931, BM551313, BM680161, BM724931, BM829941, BM911556, BQ230563, BQ440441, BT007104, BU154979, BX475103 |
UniProt ID | P13987 |
Synonyms | 1F5; 16.3A5; EJ16; EJ30; EL32; G344; HRF-20; HRF20; MAC-IP; MACIF; MEM43; MIC11; MIN1; MIN2; MIN3; MIRL; MSK21; p18-20 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.