TRIAD3 (RNF216) Human qPCR Primer Pair (NM_207111)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
Lenti ORF particles, RNF216 (mGFP-tagged) - Human ring finger protein 216 (RNF216), transcript variant 2, 200ul, >10^7 TU/mL
USD 1,343.00
Other products for "RNF216"
Specifications
Product Data | |
Gene ID | 54476 |
Forward Sequence | GTAGTCAGGACATCAAGTGGGC |
Reverse Sequence | CCACTGGTTTCTGGTGACAGCT |
Accession No | BC004947, NM_207111, NM_207111.1, NM_207111.2, NM_207111.3, BC063825, BC063825.1, BC000787, BC040728, BM793093, BM970811, BM997118, BQ018569, BX537406, NM_207111.4 |
UniProt ID | Q9NWF9 |
Synonyms | CAHH; TRIAD3; U7I1; UBCE7IP1; ZIN |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.