ODF2L Human qPCR Primer Pair (NM_020729)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
Lenti ORF particles, ODF2L (mGFP-tagged) - Human outer dense fiber of sperm tails 2-like (ODF2L), transcript variant 1, 200ul, >10^7 TU/mL
USD 850.00
Other products for "ODF2L"
Specifications
Product Data | |
Gene ID | 57489 |
Forward Sequence | AACGGAGGCTTCACGAGTGTCA |
Reverse Sequence | GCTTTGTCAGAAGATTGTGATTTCC |
Accession No | BC009779, NM_020729, NM_020729.1, NM_020729.2, BC009779.1, BC091490, BC012579, BC026105, BC029420, BC047368, BG777878, BI768058, BM971230, BM993592, BQ894001, BX499763, NM_020729.3 |
UniProt ID | Q9ULJ1 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.