CD98 (SLC3A2) Human qPCR Primer Pair (NM_002394)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
SLC3A2 (Myc-DDK-tagged)-Human solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 (SLC3A2), transcript variant 3
USD 586.00
Other products for "SLC3A2"
Specifications
Product Data | |
Gene ID | 6520 |
Forward Sequence | CCAGAAGGATGATGTCGCTCAG |
Reverse Sequence | GAGTAAGGTCCAGAATGACACGG |
Accession No | NM_002394, NM_002394.1, NM_002394.2, NM_002394.3, NM_002394.4, NM_002394.5, BC001061, BC001061.2, BC003000, BC003000.1, BE018712, BQ128156, BU556953, BX362778, BX443653, NM_002394.6 |
UniProt ID | P08195 |
Synonyms | 4F2; 4F2HC; 4T2HC; CD98; CD98HC; MDU1; NACAE |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.