HSP90AA1 Human qPCR Primer Pair (NM_005348)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
HSP90AA1 (Myc-DDK-tagged)-Human heat shock protein 90kDa alpha (cytosolic), class A member 1 (HSP90AA1), transcript variant 2
USD 670.00
Anti-HSP90AA1 (Hsp90 alpha) mouse monoclonal antibody, clone OTI3B5 (formerly 3B5)
USD 447.00
Other products for "HSP90AA1"
Specifications
Product Data | |
Gene ID | 3320 |
Forward Sequence | TCTGCCTCTGGTGATGAGATGG |
Reverse Sequence | CGTTCCACAAAGGCTGAGTTAGC |
Accession No | NM_005348, NM_005348.1, NM_005348.2, NM_005348.3, BC000987, BC001695, BC007989, BC017233, BC023006, BC108695, BC121062, BX247955, BX248761, NM_005348.4 |
UniProt ID | P07900 |
Synonyms | EL52; HEL-S-65p; HSP86; Hsp89; HSP89A; Hsp90; HSP90A; HSP90N; Hsp103; HSPC1; HSPCA; HSPCAL1; HSPCAL4; HSPN; LAP-2; LAP2 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.