Nesprin 1 (SYNE1) Human qPCR Primer Pair (NM_182961)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
SYNE1 (Myc-DDK-tagged)-Human spectrin repeat containing, nuclear envelope 1 (SYNE1), transcript variant 3
USD 899.00
Other products for "SYNE1"
Specifications
Product Data | |
Gene ID | 23345 |
Forward Sequence | AGAGCCAAGTCCTCAACCACCT |
Reverse Sequence | CACCGAAGCATTTGACAGGTCAC |
Accession No | NM_182961, NM_182961.1, NM_182961.2, NM_182961.3, BC028616, BC039121, BC090927, BC150289, BK000543, BX501371, BX537517, BX537837, BX647837 |
UniProt ID | Q8NF91 |
Synonyms | 8B; AMC3; AMCM; ARCA1; C6orf98; CPG2; dJ45H2.2; EDMD4; KASH1; MYNE1; Nesp1; SCAR8 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.