FAM222B Human qPCR Primer Pair (NM_018182)

CAT#: HP232201

qSTAR qPCR primer pairs against Homo sapiens gene FAM222B

USD 95


Availability*
5 Days

Size
    • 200 rxns

Product images

Specifications

Product Data
Gene ID 55731
Forward Sequence GACCGTGTCTACCTCAACTATCC
Reverse Sequence CACACTGAGGTAGTGCTGATGC
Accession No NM_001077498, NM_001288631, NM_001288632, NM_001288633, NM_001288634, NM_001288635, NM_001288636, NM_001288637, NM_001288638, NM_001288639, NM_001288640, NM_018182, XM_011524986, XM_011524987, XM_011524988, XM_017024831, XM_017024832, XM_017024833, XM_017024834, XM_017024835
Synonyms C17orf63; C17orf63
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping when stored at -20 degrees C
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents